rs6673093 chr1:78964666 A>G
- Sequence
tagtaaaactgtgtgctctgtcat[A/G]gggtaattgcaaattggcatacca
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- PKNX1_HUMAN CTBP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -3.08 | 3.46 | 1.00 | -0.70 | Weak Discordant | |||
| CTBP1_HUMAN | n/a | 3.00 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, endometriosis, obesity with early age of onset (age >2), tetrology of fallot, total cholesterol, transmission distortion