rs6673372 chr1:211633507 A>T
- Sequence
aacttgggtgagccacctggcctc[A/T]tcaggtcccagctttgtcagctgt
- ASB in cell types
- K562 (myelogenous leukemia) MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.20 | 0.90 | 2.94 | |||
| MCF10A (breast epithelial cells) | -0.80 | 2.18 | 1.00 |
Items per page:
1 – 2 of 2