rs6673462 chr1:66996174 A>C
- Sequence
aaacacatagtcggccctcagtaa[A/C]tactgcttttccttcctcttaaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) foreskin keratinocyte MS-1 (Small cell lung carcinoma) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.37 | 0.87 | 1.13 | |||
| foreskin keratinocyte | 0.80 | n/a | 2.67 | |||
| MS-1 (Small cell lung carcinoma) | -0.42 | 0.40 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.75 | -0.10 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, cystatin c in serum, height, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood