rs6673869 chr1:172451332 C>T
- Sequence
tgagtcagagtgaagataagaaca[C/T]tatttattttgcttttagcagacc
- ASB in cell types
- HepG2 (hepatoblastoma) TTC-1240 (Rhabdoid tumor of the kidney) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN SSXT_HUMAN TEAD3_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -1.46 | 2.50 | 2.00 | n/a | No Hit | |||
| SSXT_HUMAN | -2.33 | 2.73 | 1.00 | n/a | n/a | |||
| TEAD3_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit | |||
| FOXA2_HUMAN | 1.47 | -0.68 | 1.17 | -0.44 | Weak Concordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP asthma, diabetic retinopathy in type 2 diabetes mellitus, hip bone mineral density (bmd), partial epilepsy, spine bone mineral density (bmd), waist hip ratio
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood