rs6676300 chr1:11865243 A>G
- Sequence
gtgtgaggctgccggagaaaggat[A/G]agaggtccgtcccagaatctcgcc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | 3.75 | -2.88 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at death with kuru exposure, bipolar disorder, cystatin c in serum, diastolic blood pressure (dbp), hdl cholesterol change with statins, late onset alzheimers disease, n-terminal signal peptide of pro-b-type natriuretic peptide blood level, plasma brain natriuretic peptide (bnp), systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood