rs6676711 chr1:31816398 G>T
- Sequence
atataggtaaacttgtgtcacggg[G/T]gttgttgtacagattatttcgtca
- ASB in cell types
- K562 (myelogenous leukemia) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.52 | 0.69 | 1.03 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 2.10 | -1.58 | 1.00 |
Items per page:
1 – 2 of 2