rs6677835 chr1:234499206 A>G
- Sequence
tatgaggtctgtcaatggggtaaa[A/G]gcccggatggtgcgcccaatgtca
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) TF-1 (erythroleukemia) K562 (myelogenous leukemia) MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
- ASB for transcription factors
- GATA2_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | -3.65 | 1.85 | 2.00 | n/a | No Hit | |||
| STAG1_HUMAN | 1.14 | 0.26 | 1.36 | n/a | n/a |
Items per page:
1 – 2 of 2