rs6678192 chr1:210448327 A>C
- Sequence
aactcctgacctcaggtgatctgc[A/C]cacctcagtttcccaaagtgttgg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -1.08 | 1.06 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.21 | -0.97 | 1.00 | |||
| LNCaP (prostate carcinoma) | 1.21 | -0.79 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 0.92 | -0.79 | 1.00 |
Items per page:
1 – 4 of 4