rs6678847 chr1:2444067 C>T
- Sequence
ccctggtgcgggtcggggctgagc[C/T]gcctgggcttcagactcgggagcg
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.91 | 1.66 | 1.00 | |||
| adrenal gland | 1.99 | -0.23 | 1.00 |
Items per page:
1 – 2 of 2