rs6679038 chr1:47997872 T>C
- Sequence
gcggactggtggcagcgacagatt[T/C]ggggaccagcctcgcccaacgcat
- ASB in cell types
- RCC 7860 (Renal cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RCC 7860 (Renal cell carcinoma) | 2.63 | -4.57 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Thyroid