rs6679358 chr1:15691581 C>G
- Sequence
cggtttgggcagacagtgcctcac[C/G]ggcgtcggctctgagtgaagttct
- ASB in cell types
- gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | n/a | 2.19 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Thyroid