rs6679985 chr1:231602083 G>C
- Sequence
ttttttaagagcatgaatttaagt[G/C]tcactcattctcccatgtaaacat
- ASB in cell types
- HEK293 (embryonic kidney) TTC-1240 (Rhabdoid tumor of the kidney) VCaP (prostate carcinoma)
- ASB for transcription factors
- SSXT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSXT_HUMAN | -2.34 | 2.70 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1