rs6680324 chr1:209747848 T>C
- Sequence
cgcaatctccttgcccagtgcgta[T/C]caggttctaccccagggcggccac
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) KB (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 1.72 | 0.48 | 1.38 | |||
| KB (cervical adenocarcinoma) | -0.60 | 1.53 | 1.50 |
Items per page:
1 – 2 of 2