rs6680621 chr1:30854119 G>T
- Sequence
acatatcaaccattaaaggctggt[G/T]ctccttggcataggggacccaagt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.86 | 0.90 | 1.04 | |||
| HEK293 (embryonic kidney) | -0.10 | 0.66 | 2.00 |
Items per page:
1 – 2 of 2