rs6682685 chr1:231602464 G>A
- Sequence
atggcgtgaaaccatatcacattt[G/A]tgggccatgggctgggagattgaa
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN PRDM6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -3.31 | 2.22 | 2.00 | n/a | No Hit | |||
| PRDM6_HUMAN | n/a | 2.37 | 4.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Spleen, Testis, Whole_Blood