rs6683931 chr1:117516526 C>T
- Sequence
tcagcaaattgtttgacacagtct[C/T]tcacaatggatgagtggaacttct
- ASB in cell types
- Kasumi-1 (acute myeloblastic leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | -2.79 | 1.92 | 1.33 | 4.70 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Muscle_Skeletal, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg