rs6684355 chr1:228486873 C>T
- Sequence
ggcccacgcaggccatttcccgcc[C/T]cgtccccagcccacgcgggcgagc
- ASB in cell types
- primary B-CLL cells breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.44 | -3.95 | 2.50 | |||
| breast tumor | 1.94 | 0.10 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid