rs6684534 chr1:6625962 G>C
- Sequence
taatgtacatgcagaaaaatgcac[G/C]aatcataagtatacagcccagcga
- ASB in cell types
- HEK293 (embryonic kidney) MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.03 | 1.27 | 1.99 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | -0.27 | 1.97 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood