rs6685440 chr1:224209518 C>T
- Sequence
gtttgttaatacacttgtgcataa[C/T]tttgctcaccttctttttctgttg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.29 | -0.11 | 1.07 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (broad definition) (males), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood