rs6687560 chr1:27097869 C>G
- Sequence
acccaggctggagtgcagtggttc[C/G]atctcagctcactgcaaccttcac
- ASB in cell types
- K562 (myelogenous leukemia) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.81 | 0.62 | 1.04 | |||
| macrophages | 1.70 | -0.87 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Testis, Thyroid, Whole_Blood