rs6687802 chr1:236775067 A>G
- Sequence
aattaggagacgtggacagtgaag[A/G]ctgagccgtatgactcccaaatgg
- ASB in cell types
- LNCaP (prostate carcinoma) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.92 | 1.58 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, ldl cholesterol, postoperative nausea and vomiting, refractive error, triglycerides