rs6688376 chr1:154353890 C>T
- Sequence
agctccttcctctgttcttcttcc[C/T]accatgccccaggactccatactt
- ASB in cell types
- HEK293 (embryonic kidney) SK-BR-3 (breast adenocarcinoma) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.61 | 0.04 | 2.00 | |||
| SK-BR-3 (breast adenocarcinoma) | -0.35 | 1.44 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.08 | -0.59 | 1.00 |
Items per page:
1 – 3 of 3