rs6689719 chr1:91569746 G>A
- Sequence
atgtgcaaagtcacagagtaggaa[G/A]cggaggtaggtcactcacaaagga
- ASB in cell types
- K562 (myelogenous leukemia) SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.30 | 2.24 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, salmonella-induced pyroptosis, triglycerides, triglycerides change with statins