rs6691080 chr1:167171722 A>G
- Sequence
gaatcttctgctctctctcagtcc[A/G]ctgactcacaccctcacaggcatg
- ASB in cell types
- foreskin keratinocyte HMEC (human mammary epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.35 | 1.95 | 1.58 | n/a | No Hit | |||
| STAG2_HUMAN | -1.70 | 2.26 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hip bone mineral density (bmd), ldl cholesterol, schizophrenia, total cholesterol, triglycerides