rs6693322 chr1:36099761 T>C
- Sequence
ctcacctctcatccctgcatgacc[T/C]gaaggtggagtggccaccaggtgg
- ASB in cell types
- K562 (myelogenous leukemia) glioblastoma cells MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) HMEC (human mammary epithelial cells)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.20 | -0.68 | 4.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Lung, Muscle_Skeletal, Thyroid, Whole_Blood