rs6693346 chr1:170865861 A>G
- Sequence
tgacaagcacatgttgagcacatg[A/G]taggcaaggtagttccttgtttct
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | n/a | 2.92 | 1.50 | 3.64 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
