rs6693632 chr1:162678553 T>C
- Sequence
taatccaaagtcctcttttgtaaa[T/C]gaggaatcactggcccaaggtcac
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 2.03 | -0.55 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, body mass index (bmi), college completion, comorbid depressive syndrome and alcohol dependence, height, parkinsons disease, transmission distortion