rs6693769 chr1:94805973 T>C
- Sequence
atcaatgaagaaaaccacacagtt[T/C]gtcttgacaacacagccactggcc
- ASB in cell types
- THP-1 (acute monocytic leukemia) neutrophils from periferal blood GM12878 (female B-cells lymphoblastoid cell line) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- STAG1_HUMAN SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.45 | 0.70 | 1.00 | n/a | n/a | |||
| SMCA5_HUMAN | n/a | 2.40 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood