rs6694713 chr1:205544054 T>A
- Sequence
tggaaggagtcaaaattgtattat[T/A]ttttgtttacaacacctgacccca
- ASB in cell types
- MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | 2.31 | -1.70 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial