rs6695075 chr1:117683747 C>T
- Sequence
gtaaacagcatacctcagagaggg[C/T]gcagctgcctcctctgcattctca
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| OCI-LY7 (diffuse large B-cell lymphoma) | -1.49 | 1.84 | 1.00 |
Items per page:
1 – 1 of 1