rs6696556 chr1:152458366 G>T
- Sequence
gactgaaaagaaaattggaatttt[G/T]attgaaagatcattttgactaggt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.16 | 0.88 | 2.65 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP atopic dermatitis, atopic dermatitis with bronchial asthma, neuroblastoma (brain cancer), parkinsons disease, partial epilepsy, serum creatinine, total cholesterol
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid