rs6696627 chr1:217134705 T>C
- Sequence
ccgagcgcacagctcttccccgcg[T/C]gtttggcgcggctacgtttctctt
- ASB in cell types
- A673 (Ewing sarcoma) TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A673 (Ewing sarcoma) | -2.31 | 2.73 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | -0.96 | 1.83 | 1.00 |
Items per page:
1 – 2 of 2