rs6696880 chr1:66335812 A>G
- Sequence
cctcctgccagctgcccaaattcg[A/G]ttagacatgttagagctagccgtt
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.36 | -2.52 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, birth weight, fasting blood glucose, hdl cholesterol, hdl cholesterol change with statins, mitral annular calcium, systolic blood pressure (sbp)