rs6696928 chr1:16963563 A>G
- Sequence
gccttttgggtggtgaccaagttc[A/G]tggctgcggagcagttttggtgtc
- ASB in cell types
- coronary artery HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery | -2.41 | 2.65 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | 1.54 | 0.04 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, height, mitral annular calcium, parkinsons disease, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid