rs6697778 chr1:35661058 C>A
- Sequence
gtagtggcaaatgaggattgtggt[C/A]aagaccatggacagatgccgtggg
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 1.83 | -0.82 | 1.00 | -3.32 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), comorbid depressive syndrome and alcohol dependence, ldl cholesterol change with statins, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol change with statins