rs6698482 chr1:58065955 G>A
- Sequence
ctccctgtagccgaggcaatccca[G/A]ggaaggttagcaagtgcaagctgt
- ASB in cell types
- GM17942 (lymphoblastoid cell)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.26 | 2.01 | 1.06 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), irritible bowel syndrome, parkinsons disease, primary rhegmatogenous retinal detachment, years of education