rs6699388 chr1:241408282 A>G
- Sequence
accagataacaatgttcccaaaag[A/G]tcacaaataatgctcaaaacaaca
- ASB in cell types
- neural cell K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.43 | -0.02 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.34 | 1.09 | 2.84 |
Items per page:
1 – 2 of 2