rs6699947 chr1:176881151 C>G
- Sequence
gaatgtcactcctggcctcccaca[C/G]ggccctcttcttgtgatctgcagc
- ASB in cell types
- neutrophils from periferal blood foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.47 | 0.08 | 1.50 | |||
| foreskin keratinocyte | 0.35 | n/a | 2.67 |
Items per page:
1 – 2 of 2