rs6700698 chr1:39196982 C>T
- Sequence
caaggcttctttcatggtttgggg[C/T]cctgcccgttggctgttagtaagg
- ASB in cell types
- Th1-cells
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 2.31 | -1.86 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, coronary artery disease (cad), cystatin c in serum, fasting blood glucose, homa-ir, sporadic creutzfeldt-jakob disease, triglycerides, variant creutzfeldt-jakob disease
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Lung, Skin_Sun_Exposed_Lower_leg, Whole_Blood