rs6700983 chr1:83860755 C>A
- Sequence
aggccggcccgggcggttcttccc[C/A]aggtggtccggggcgtcccgggcc
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.13 | n/a | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Heart_Atrial_Appendage, Heart_Left_Ventricle, Testis, Thyroid