rs6700998 chr1:152461533 T>G
- Sequence
tcattttaggttttactaactcac[T/G]cttatcctttaatctggccacaca
- ASB in cell types
- H929 (plasma cell myeloma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.27 | -3.82 | 1.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.02 | -0.03 | 2.65 |
Items per page:
1 – 2 of 2