rs6701637 chr1:156797461 C>T
- Sequence
tttagcagcccatcttttagcagg[C/T]atcctctcctattctcagagcggc
- ASB in cell types
- H929 (plasma cell myeloma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | n/a | 0.86 | 1.50 | |||
| THP-1 (acute monocytic leukemia) | 0.33 | 0.80 | 2.00 |
Items per page:
1 – 2 of 2