rs6702652 chr1:162627755 T>G
- Sequence
atgtcaaaagttctgctttatata[T/G]cctgaatctcccctcctgctaatt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.05 | 0.85 | 2.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, birth weight, coronary artery disease (cad), infant head circumference, nausea in response to topiramate treatment in healthy volunteers, recurrent early onset major depressive disorder (females), recurrent early onset major depressive disorder (males)