rs679556 chr11:119372005 C>G
- Sequence
tgccccaagagaggcgtgtgcggg[C/G]attagttggcgagcgagcccatgc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.92 | 2.20 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.17 | -1.15 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid