rs680413 chr11:65422908 G>T
- Sequence
agagatgactgagttagatgagac[G/T]agggggcgggctgggggtgcgaga
- ASB in cell types
- A549 (lung carcinoma) HepG2 (hepatoblastoma) HeLa-LTR-Luciferase cells GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TYY1_HUMAN CTCF_HUMAN PBIP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 0.29 | 3.23 | 1.83 | n/a | No Hit | |||
| CTCF_HUMAN | 0.01 | 1.43 | 1.12 | 2.23 | Concordant | |||
| PBIP1_HUMAN | -2.52 | 2.84 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid