rs681048 chr18:42113702 A>G
- Sequence
atggaatggggaagtgagaagcag[A/G]aacagaaaaactgagaaaaaaaat
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.00 | 3.00 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.23 | 0.95 | 1.08 | |||
| monocyte-derived dendritic cells | -0.43 | 1.44 | 1.25 | |||
| macrophages form periferal blood | -0.07 | 2.28 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid