rs681900 chr2:74847840 T>C
- Sequence
cacagtgtgtctgggcagccagac[T/C]ttctcctgacactaacccttactg
- ASB in cell types
- macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | 2.58 | -1.59 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, aortic valve calcium, appendicular lean mass-femoral neck buckling ratio bivariate association, appendicular lean mass-femoral neck cortical thickness bivariate association, appendicular lean mass-femoral neck cross-sectional area bivariate association, appendicular lean mass-femoral neck periosteal diameter bivariate association, appendicular lean mass-femoral neck section modulus bivariate association, barnes akathisia rating scale, lp-pla2 mass, neuroticism, transmission distortion