rs681966 chr10:6191337 G>A
- Sequence
cagggaccgctcaagacccgttgc[G/A]tgccaagggtcttgacaaaggaat
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -1.11 | 2.05 | 1.17 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, infant head circumference, late onset alzheimers disease, partial epilepsy, rheumatoid arthritis, serum creatinine