rs682658 chr1:22642322 G>T
- Sequence
tgcagtatccatcatttcttctcg[G/T]cccaggcttccacccaccagggac
- ASB in cell types
- erythroid cells glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | -5.32 | 3.14 | 2.00 | |||
| glioblastoma cells | -3.01 | 1.96 | 1.50 |
Items per page:
1 – 2 of 2