rs684225 chr10:97882605 C>A
- Sequence
agcctgtgggtcactaatatcact[C/A]ccaccctggtgagtcatgtggtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MDA-MB-231 (breast adenocarcinoma) Detroit 562 (Pharyngeal squamous cell carcinoma) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -1.51 | 1.89 | 1.00 | |||
| MDA-MB-231 (breast adenocarcinoma) | 0.07 | 1.14 | 2.00 | |||
| Detroit 562 (Pharyngeal squamous cell carcinoma) | 0.79 | -0.14 | 1.00 | |||
| MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) | 0.42 | 1.32 | 2.00 | |||
| OCUM-1 (Signet ring cell gastric adenocarcinoma) | -1.85 | 2.24 | 1.00 |
Items per page:
1 – 5 of 6